rs638822 chr13:30046921 A>G
- Sequence
tcaggaagactcatcctaggatgg[A/G]gtcagggtggcttcatgttccagg
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PRDM9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRDM9_HUMAN | -2.39 | 2.47 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1