rs639216 chr1:119674791 C>T
- Sequence
ttaaataaatcatgatacaataga[C/T]tgaaggatgtaatcggtccagatg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN CEBPB_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.05 | -0.98 | 2.00 | n/a | No Hit | |||
| CEBPB_HUMAN | 2.12 | -2.17 | 1.33 | n/a | No Hit | |||
| ARI1B_HUMAN | 2.12 | -1.92 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, diastolic blood pressure (dbp), hdl cholesterol, hip bone mineral density (bmd), microalbuminuria, obesity with early age of onset (age >2), systolic blood pressure (sbp), total cholesterol
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis