rs640256 chr11:125942176 G>A
- Sequence
gggagccgccgcttcctctcagga[G/A]agccaggtgtgcccagccatcctc
- ASB in cell types
- H1 (embryonic stem cells) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H1 (embryonic stem cells) | 1.48 | 0.42 | 1.38 | |||
| neural cell | -0.41 | 1.18 | 1.22 |
Items per page:
1 – 2 of 2