rs6426833 chr1:19845367 G>A
- Sequence
tttgtttcctgaaacagctgagtc[G/A]gcaacggagagaccttcctccagt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.44 | 0.71 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic inflammatory diseases (ankylosing spondylitis, crohns disease, psoriasis, primary sclerosing cholangitis, ulcerative colitis) (pleiotropy), inflammatory bowel disease, ulcerative colitis
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (geographic atrophy), irritable bowel disorder, prostate cancer, selective immunoglobulin a deficiency (igad), tardive dyskinesia, ulcerative colitis
PheWAS abnormal chest sounds, abnormal findings on radiological exam of musculoskeletal system, abnormal glucose, abnormal weight gain, adverse effects of opiates and related narcotics in therapeutic use, allergy to serum or vaccine, allergy/adverse effect of penicillin, ankylosing spondylitis, ankylosis of joint, arthralgia/ankylosis of temporomandibular joint, back pain, bacterial enteritis, benign neoplasm of other parts of digestive system, bursitis, cancer of other male genital organs, cardiac complications, not elsewhere classified, cardiomyopathy, chronic obstructive asthma with exacerbation, coronary atherosclerosis, degeneration of intervertebral disc, dental caries, diseases of hard tissues of teeth, diseases of the larynx and vocal cords, dystrophy of female genital tract, early complications of trauma or procedure, elevated blood pressure reading, generalized anxiety disorder, hyperventilation, hypoventilation, injuries to the nervous system, intestinal malabsorption, intestinal malabsorption nos, ischemic heart disease, joint/ligament sprain, malignant neoplasm of renal pelvis, malunion fracture, mastodynia, megaloblastic anemia, nephritis & nephropathy, nodular lymphoma, noninflammatory female genital disorders, nonsenile cataract, other abnormal glucose, other acquired musculoskeletal deformity, other disorders of bone and cartilage, other disorders of soft tissues, other paralytic syndromes, other pulmonary inflamation or edema, other specified intestinal malabsorption, ovarian dysfunction, patellar fracture, pernicious anemia, poisoning by antibiotics, poisoning by other anti-infectives, postmenopausal bleeding, primary/intrinsic cardiomyopathies, protein-calorie malnutrition, respiratory abnormalities, respiratory failure, respiratory failure, insufficiency, arrest, secondary malignant neoplasm of digestive systems, sepsis and sirs, septicemia, sinoatrial node dysfunction, spinal stenosis, spinal stenosis of lumbar region, sulfonamides, symptomatic artificial menopause, symptoms and disorders of the joints, syncope and collapse, synoviopathy, temporomandibular joint disorder nos, unspecified monoarthritis, urticaria, vitamin b12 deficiency anemia, voice disturbance
GTEx eQTL Adrenal_Gland, Brain_Frontal_Cortex_BA9, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Thyroid