rs643027 chr12:52691088 C>T
- Sequence
taagaaaagtgaatgagaggggat[C/T]aggaagggcgtggaggggaggagt
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.05 | 0.48 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol consumption, arthritis including non-rheumatoid, chronic kidney disease, college completion, comorbid depressive syndrome and alcohol dependence, height, irritible bowel syndrome, neuroblastoma (brain cancer), years of education