rs643459 chr6:131116923 G>A
- Sequence
aaccctaccaatgtagtatgaaac[G/A]ccaagtaaggaatttaagttgttc
- ASB in cell types
- foreskin keratinocyte HepG2 (hepatoblastoma) PC9 (lung adenocarcinoma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.00 | n/a | 2.17 | |||
| HepG2 (hepatoblastoma) | 0.84 | -0.19 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 2.66 | n/a | 4.00 | |||
| A549 (lung carcinoma) | 0.62 | 0.40 | 1.15 | |||
| GM12878 (female B-cells) | 0.77 | 0.34 | 1.36 |
Items per page:
1 – 5 of 6