rs6435721 chr2:212686370 G>T
- Sequence
actgtaatcattaaggacacagaa[G/T]aatgggcaacgtgtttgaaaataa
- ASB in cell types
- A549 (lung carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | -0.14 | 0.81 | 2.08 | |||
| foreskin keratinocyte | 0.77 | n/a | 2.67 |
Items per page:
1 – 2 of 2