rs6438720 chr3:122298385 A>C
- Sequence
gacaccttcacacttgccctttct[A/C]ggcctcagttttctaatgtgtcca
- ASB for transcription factors
- COT1_HUMAN ZN687_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | -1.44 | 1.23 | 1.33 | 2.05 | Concordant | |||
| ZN687_HUMAN | 1.17 | -1.45 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, diabetic retinopathy in type 2 diabetes mellitus, obesity with early age of onset (age >2), serum calcium
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood