rs6442322 chr3:12648359 A>G
- Sequence
aaaaaatcacctggaaacactaac[A/G]atttccacactaatttctctttca
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.36 | 0.72 | 1.29 | |||
| HEK293 (embryonic kidney) | 0.02 | 0.80 | 1.77 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), arthritis including non-rheumatoid, bipolar disorder, college completion, diastolic blood pressure (dbp), ldl cholesterol, obesity with early age of onset (age >2), rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood