rs644401 chr1:236687130 G>C
- Sequence
tgagtctgtgaccttggcccccga[G/C]ttatactctcctggcccgcttgtg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.39 | 0.72 | 3.73 | |||
| HEK293T (embryonic kidney) | -0.54 | 0.97 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Whole_Blood