rs6444106 chr3:186093706 G>A
- Sequence
agtgtggggggcactccaaactcc[G/A]gggggagctcaagacttgccctac
- ASB in cell types
- foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 1.65 | 2.00 | 2.77 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, body mass index (bmi), hdl cholesterol, obesity with early age of onset (age >2), serum creatinine, stabilized warfarin dose, years of education