rs645976 chr18:56576323 T>C
- Sequence
gtggcagaaggtgggaaaacaatt[T/C]ttaatcctatttgatattcactgt
- ASB in cell types
- A673 (Ewing sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A673 (Ewing sarcoma) | 1.72 | -1.43 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), spine bone mineral density (bmd)