rs6464585 chr7:140196624 T>A
- Sequence
ttattctgaacaagttggcaagag[T/A]ttaggttacaaaaagactgtggct
- ASB in cell types
- HepG2 (hepatoblastoma) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.19 | -0.15 | 1.36 | |||
| periferal blood macrophages | -1.68 | 1.74 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, barnes akathisia rating scale, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), hdl cholesterol, infant head circumference, systolic blood pressure (sbp), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Testis