rs646634 chr5:18066359 T>G
- Sequence
gataaagcagtggcagtggggaga[T/G]aaacattcaataacaataaaagaa
- ASB in cell types
- HUES64 (embryonic stem cells)
- ASB for transcription factors
- GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA4_HUMAN | 2.24 | n/a | 1.33 | -3.07 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
