rs6475120 chr9:1732880 G>A
- Sequence
tggttacataagagtgccacctac[G/A]ggcaaggggtaatgcatcatggca
- ASB in cell types
- epithelial cell of prostate LNCaP C4-2B (prostate carcinoma) foreskin keratinocyte LNCaP (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.44 | 2.40 | 1.48 | 2.40 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, ldl cholesterol, obesity with early age of onset (age >2), partial epilepsy, years of education