rs6479503 chr9:93682204 A>G
- Sequence
ggccaggtcagtctattctgcagg[A/G]ccctgcctatatatgtgcccacat
- ASB in cell types
- KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 | -2.79 | 2.21 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, neuroblastoma (brain cancer), prop taste detection threshold, sporadic creutzfeldt-jakob disease, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid