rs6488782 chr12:15526186 C>A
- Sequence
tgcaattctcagcttgcctccagg[C/A]gacatctataacctctcagtaact
- ASB in cell types
- GM12878 (female B-cells) transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.33 | 0.76 | 1.31 | |||
| transverse colon | -1.84 | 1.96 | 1.00 |
Items per page:
1 – 2 of 2