rs649297 chr5:18067829 G>A
- Sequence
tacaggttgcacattcctaatcgg[G/A]aaatctggtcataaatgctccaaa
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 1.20 | -0.86 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), infant head circumference, triglycerides change with statins