rs649447 chr18:49796154 C>G
- Sequence
ggctaagaatagtaattcttaaca[C/G]aatataaatcttgaaaatcaacag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | n/a | 1.66 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Transverse, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid