rs649465 chr11:97625366 A>G
- Sequence
ctcccaaagagaatatatgatgac[A/G]tatgttactttagccataataggg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells)
- ASB for transcription factors
- ATF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF2_HUMAN | -1.65 | 2.45 | 1.56 | -3.52 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, hypertension (early onset hypertension), rheumatoid arthritis, triglycerides