rs649664 chr1:22997770 C>T
- Sequence
agcgggggaatgtcacaaggttga[C/T]tgattagttgggctggggtaggaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MEIS2_HUMAN PKNX1_HUMAN NCOR1_HUMAN PBX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEIS2_HUMAN | n/a | 2.72 | 1.33 | n/a | No Hit | |||
| PKNX1_HUMAN | n/a | 2.49 | 1.33 | n/a | No Hit | |||
| NCOR1_HUMAN | -1.48 | 1.28 | 1.33 | n/a | n/a | |||
| PBX2_HUMAN | -2.17 | 1.91 | 1.50 | 2.18 | Concordant | |||
| HTF4_HUMAN | -0.63 | 1.17 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid