rs649729 chr2:31241519 T>A
- Sequence
tgcaatgaatttaatccccagaac[T/A]ccctgtgagataggttttcttatt
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.83 | 0.04 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI high light scatter reticulocyte count, high light scatter reticulocyte percentage of red cells, mean platelet volume, reticulocyte fraction of red cells
GRASP mean platelet volume (mpv), microalbuminuria, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid