rs6501725 chr17:68759989 G>A
- Sequence
ctgggctgtcttgaaatctgaggg[G/A]aaaagtctgtgaggcgtggccggc
- ASB in cell types
- GM12878 (female B-cells) OCI-LY7 (diffuse large B-cell lymphoma) HAEC (human aortic endothelial cells)
- ASB for transcription factors
- CTCF_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.81 | 0.30 | 1.50 | n/a | No Hit | |||
| FOXK2_HUMAN | 1.92 | -1.95 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), hip bone mineral density (bmd), neuroblastoma (brain cancer), spine bone mineral density (bmd), years of education