rs6503637 chr17:38465315 C>T
- Sequence
tatttgtgtgtgtttcattgtgtt[C/T]tactgtgtgtgtgtgtgtctctgg
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.72 | 0.96 | 1.71 | |||
| A549 (lung carcinoma) | 1.22 | -1.06 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), total cholesterol