rs650627 chr9:133030670 C>T
- Sequence
ggctcaaaaaaaaactcgctcggc[C/T]ctcggattctcattggctgaagtc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) Jurkat (T-cells) HEK293T (embryonic kidney)
- ASB for transcription factors
- SP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SP1_HUMAN | 1.21 | 0.16 | 1.47 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg