rs6509 chr22:39318485 C>T
- Sequence
ggctgtgaggtggaccggcttgga[C/T]gggtcatccttagggaagctcttc
- ASB in cell types
- HEK293 (embryonic kidney) coronary artery smooth muscle
- ASB for transcription factors
- ZBT17_HUMAN JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT17_HUMAN | -2.35 | 2.40 | 2.00 | n/a | No Hit | |||
| JUND_HUMAN | -1.64 | 1.45 | 1.33 | 5.27 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Heart_Left_Ventricle, Liver, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood