rs650979 chr11:127074424 T>A
- Sequence
ccaccccatgccccactctctgcg[T/A]ctcaggcccacagtgctgagaccg
- ASB in cell types
- GM12878 (female B-cells) RWPE2 MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.73 | 0.30 | 1.29 | |||
| RWPE2 | -1.96 | 1.86 | 1.00 | |||
| MM1.S (plasma cell myeloma) | 1.14 | -0.74 | 1.42 |
Items per page:
1 – 3 of 3