rs650980 chr11:127074423 G>T
- Sequence
cccaccccatgccccactctctgc[G/T]tctcaggcccacagtgctgagacc
- ASB in cell types
- GM12878 (female B-cells) RWPE2
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.72 | 0.30 | 1.29 | |||
| RWPE2 | -1.96 | 1.86 | 1.00 |
Items per page:
1 – 2 of 2