rs651039 chr17:49496673 C>A
- Sequence
cacctagctgcgcgacccgagcgc[C/A]gcgcccaccgcgctccgtgggctc
- ASB in cell types
- K562 (myelogenous leukemia) erythroid cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.05 | 0.65 | 2.00 | |||
| erythroid cells | 2.09 | -2.62 | 1.50 | |||
| HepG2 (hepatoblastoma) | 0.69 | -0.19 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Putamen_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Nerve_Tibial, Thyroid