rs6510639 chr19:2053670 C>T
- Sequence
actacaggtacgcgccaccacgcc[C/T]agctaacttctttgtgtgtatttt
- ASB in cell types
- GM12878 (female B-cells) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.83 | 0.35 | 1.31 | |||
| HEK293 (embryonic kidney) | -0.33 | 0.51 | 1.98 |
Items per page:
1 – 2 of 2