rs651220 chr7:105743013 C>T
- Sequence
aggaagtgattctttgtgggcagc[C/T]caacctctgaaggtcaagctcatt
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.63 | 0.32 | 1.46 | |||
| periferal blood macrophages | 1.27 | -0.15 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, eye color, hdl cholesterol, hypertension (early onset hypertension)