rs652196 chr15:40083946 A>G
- Sequence
ttgcaccatcctccatcaccgtgt[A/G]cacagggtgaaatgtacatgcgac
- ASB in cell types
- HepG2 (hepatoblastoma) macrophages
- ASB for transcription factors
- FOXA2_HUMAN CEBPB_HUMAN MNT_HUMAN FOXA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 2.89 | n/a | 1.33 | n/a | No Hit | |||
| CEBPB_HUMAN | 1.20 | 1.92 | 1.75 | n/a | No Hit | |||
| MNT_HUMAN | 1.23 | -1.04 | 1.17 | n/a | n/a | |||
| FOXA3_HUMAN | 1.73 | -2.03 | 1.50 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood