rs653030 chr9:86487391 G>T
- Sequence
aaatgatcaaaaaaggagaagttg[G/T]gaacaaaatttgactagactaggc
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.32 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, height, hip bone mineral density (bmd), hypertension (early onset hypertension), resistance to kuru in aged women despite likely exposure, schizophrenia, spine bone mineral density (bmd)