rs653448 chr22:20157037 C>T
- Sequence
ctgtctctgtgccccaggaccagg[C/T]tcctgggtggagggagagaccagg
- ASB in cell types
- keratinocytes HEK293 (embryonic kidney) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -3.78 | 2.93 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Minor_Salivary_Gland, Nerve_Tibial, Thyroid, Whole_Blood