rs654507 chr20:55581762 A>C
- Sequence
cactggccttagtagcaggtctct[A/C]ctctcgcttcttgtatatacatgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- HES1_HUMAN MTA2_HUMAN E4F1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HES1_HUMAN | n/a | 2.67 | 2.50 | n/a | n/a | |||
| MTA2_HUMAN | n/a | 2.50 | 2.50 | n/a | n/a | |||
| E4F1_HUMAN | n/a | 2.33 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), hdl cholesterol, obesity with early age of onset (age >2), refractive error, rheumatoid arthritis