rs656801 chr1:207904298 C>T
- Sequence
gcacctggatcaagaggagtatct[C/T]gaaggagttcctgggaatcttagt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.57 | 0.76 | 2.64 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), bipolar disorder, height, ldl cholesterol, ldl cholesterol change with statins, major depressive disorder, mitral annular calcium, parkinsons disease, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, total cholesterol, total cholesterol change with statins, triglycerides