rs657186 chr8:13115264 C>G
- Sequence
acgacacactaccctttttataaa[C/G]gtaaaaattactttgtaaaaatgt
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.64 | -0.23 | 1.85 | |||
| K562 (myelogenous leukemia) | 0.55 | -0.20 | 2.00 |
Items per page:
1 – 2 of 2