rs657523 chr10:6173324 G>A
- Sequence
ctgtagtcctcagctgctggggcc[G/A]ggcagtggtgtgctttcagcctgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.08 | 0.84 | 1.71 | |||
| HepG2 (hepatoblastoma) | 0.74 | 0.08 | 1.37 |
Items per page:
1 – 2 of 2