rs658386 chr10:6173128 C>A
- Sequence
tgccctacttgtctacttcgggaa[C/A]tctccttcaccactcacctcacac
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.80 | -1.59 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), lp-pla2 activity, primary rhegmatogenous retinal detachment, systolic blood pressure (sbp), transmission distortion, waist hip ratio, years of education