rs658469 chr10:11179403 T>C
- Sequence
gtcctttgagtttacatcgcttgc[T/C]gaaggactgtatcttgtgtgtctc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 1.46 | -0.72 | 1.87 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, alzheimers disease, college completion, maternal transmission distortion, nicotine dependence (smoking), smoking cessation (nicotine replacement therapy) , nicotine dependence (smoking), smoking cessation (with bupropion hydrochloride), simpson-angus scale, sporadic creutzfeldt-jakob disease, transmission distortion, urinary albumin-to-creatinine ratio, years of education