rs658624 chr11:118148052 G>A
- Sequence
ggtctggctcatgacacagtacac[G/A]tttctgcctggtttgtgtgcacct
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- HIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | 2.61 | n/a | 2.00 | -3.63 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), cognitive response of healthy volunteers to topiramate treatment as measure by the digit span forward cognitive test, late onset alzheimers disease, pulmonary arterial hypertension (pah), serum creatinine
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Substantia_nigra, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Pituitary, Prostate, Spleen