rs658853 chr9:133133804 G>A
- Sequence
acctggccacacacacaagcccag[G/A]ctagcaaaacccaacccacaggca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells) NCI-H2171 (small cell lung carcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 1.68 | -0.88 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1