rs659018 chr11:85941645 A>T
- Sequence
ggtatagaaatttttgtgtttgat[A/T]agggaactggccgaggtgctcggc
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.09 | 0.64 | 1.27 | |||
| A549 (lung carcinoma) | -0.25 | 0.74 | 2.00 |
Items per page:
1 – 2 of 2