rs659484 chr4:159103061 A>G
- Sequence
ttgcagcacaaagcaacaagcccc[A/G]gaggccgcttcctccctgaggagc
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages MCF7 (Invasive ductal breast carcinoma) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.19 | 1.16 | 2.00 | |||
| periferal blood macrophages | 2.56 | -2.77 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.94 | -0.24 | 2.00 | |||
| monocyte-derived dendritic cells | 2.07 | -2.77 | 2.00 |
Items per page:
1 – 4 of 4