rs6595440 chr5:123383042 G>C
- Sequence
tttttactagtccataatcttcta[G/C]agtcactgtgtaagaaagatctgc
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.32 | -0.04 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, birth weight, body mass index (bmi), diastolic blood pressure (dbp), height, microalbuminuria, systolic blood pressure (sbp), total cholesterol, triglycerides, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Cells_Cultured_fibroblasts, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Thyroid