rs659619 chr1:34786682 A>G
- Sequence
acggtgcttccagccttcgtaatt[A/G]gacttcaccctgagtacacacaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) liver foreskin keratinocyte erythroid progenitors
- ASB for transcription factors
- HNF4A_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | -2.81 | 2.59 | 1.33 | 2.40 | Concordant | |||
| FOXA1_HUMAN | -0.63 | 1.53 | 2.08 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid