rs660140 chr12:3247969 G>C
- Sequence
catgccagtggggaagcgcagcgg[G/C]gcatggaggatgatggattagaag
- ASB in cell types
- D341 Med (medulloblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D341 Med (medulloblastoma) | 0.08 | 0.71 | 2.00 |
Items per page:
1 – 1 of 1