rs6602909 chr13:113849020 T>C
- Sequence
ctggcttcatgcgctggctctgca[T/C]ggcctttctgcctccttcccacct
- ASB in cell types
- foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.64 | 1.40 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hdl cholesterol change with statins, ldl cholesterol, obesity with early age of onset (age >2), total cholesterol, triglycerides, triglycerides change with statins
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Liver, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood