rs660716 chr18:2966842 G>A
- Sequence
catgtcatgaggcttacggacaga[G/A]gttaaaacagcttttaccaaagaa
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.00 | 0.57 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, irritible bowel syndrome
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Thyroid, Whole_Blood