rs662713 chr6:35920290 G>C
- Sequence
ctgctaagacccaggcctggcgtt[G/C]agcaacagcagctctcttccacat
- ASB in cell types
- neural cell H1 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.52 | 0.93 | 1.00 | |||
| H1 (embryonic stem cells) | 1.51 | -1.30 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Pancreas, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood